Click on a specific marker to view details
GATA H4.1
GATA H4.1 (CEPH 1329-01) Example Sequence:
ATGCTGAGGAGAATTTCCAAATTTAAGATAGATAGATAGATCTATAGATAG
ATAGGTAGGTAGG/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TA
GA/TAGA/TAGA/TAGA/TAGA/ATGGATAGATTAGATGGATGAATAGC
12 repeats 138 bp (TAGA)12 Gene Diversity: 0.60313
| Alleles | Samples | Frequency | Percentage |
|---|
| 8 | 4 | 0.00013 | 0.013% | | 9 | 81 | 0.00265 | 0.265% | | 10 | 1403 | 0.04590 | 4.590% | | 10-11 | 1 | 0.00003 | 0.003% | | 11 | 11693 | 0.38252 | 38.252% | | 12 | 15082 | 0.49339 | 49.339% | | 13 | 2161 | 0.07069 | 7.069% | | 14 | 137 | 0.00448 | 0.448% | | 15 | 6 | 0.00020 | 0.020% | | Grand Total | 30568 | 1 | 100% |
Missing Data: 2556
Scientific Reference: White, P. Scott, O. Tatum, L. Deaven, J. Longmire. 1999. New, Male-Specific Microsatellite Markers from the human Y chromosome. Genomics. 57:433-437. Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Butler J.M., M.C. Kline, A.E. Decker. 2008. Addressing Y-chromosome short tandem repeat (Y-STR) allele nomenclature. J Genetic Geneal. 4:125-148.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
|