Click on a specific marker to view details
Y-GATA-A10
Y-GATA-A10 (CEPH 1358-01) Example Sequence:
CCTGCCATCTCTATTTATCTTGCATATACTTATCCATTTATTTATTCATCCATCTCTTTCT
TTCTC/TCCA/TCCA/TATC/TATC/TATC/TATC/TATC/TATC/TATC/TATC/TATC/
TATC/TATC/TATC/TATC/TAATCTATCATCTATCAATCCACCCACTATCTCCATTTAT
15 repeats 166 bp (TCCA)2 (TATC)13 Gene Diversity: 0.64488
| Alleles | Samples | Frequency | Percentage |
|---|
| 10 | 1 | 0.00003 | 0.003% | | 11 | 38 | 0.00124 | 0.124% | | 12 | 66 | 0.00215 | 0.215% | | 13 | 2121 | 0.06903 | 6.903% | | 13-14 | 1 | 0.00003 | 0.003% | | 14 | 9161 | 0.29815 | 29.815% | | 15 | 15307 | 0.49818 | 49.818% | | 15-16 | 1 | 0.00003 | 0.003% | | 16 | 3510 | 0.11424 | 11.424% | | 17 | 476 | 0.01549 | 1.549% | | 18 | 44 | 0.00143 | 0.143% | | Grand Total | 30726 | 1 | 100% |
Missing Data: 2398
Scientific Reference: White, P. Scott, O. Tatum, L. Deaven, J. Longmire. 1999. New, Male-Specific Microsatellite Markers from the human Y chromosome. Genomics. 57:433-437.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
