Click on a specific marker to view details
Y-GATA-A10
Y-GATA-A10 (CEPH 1358-01) Example Sequence:
CCTGCCATCTCTATTTATCTTGCATATACTTATCCATTTATTTATTCATCCATCTCTTTCT
TTCTC/TCCA/TCCA/TATC/TATC/TATC/TATC/TATC/TATC/TATC/TATC/TATC/
TATC/TATC/TATC/TATC/TAATCTATCATCTATCAATCCACCCACTATCTCCATTTAT
15 repeats 166 bp (TCCA)2 (TATC)13 Gene Diversity: 0.64876
| Alleles | Samples | Frequency | Percentage |
|---|
| 10 | 1 | 0.00003 | 0.003% | | 11 | 43 | 0.00127 | 0.127% | | 12 | 71 | 0.00210 | 0.210% | | 13 | 2529 | 0.07483 | 7.483% | | 13-14 | 1 | 0.00003 | 0.003% | | 14 | 10059 | 0.29765 | 29.765% | | 15 | 16691 | 0.49389 | 49.389% | | 15-16 | 1 | 0.00003 | 0.003% | | 16 | 3839 | 0.11360 | 11.360% | | 17 | 512 | 0.01515 | 1.515% | | 18 | 48 | 0.00142 | 0.142% | | Grand Total | 33795 | 1 | 100% |
Missing Data: 2397
Scientific Reference: White, P. Scott, O. Tatum, L. Deaven, J. Longmire. 1999. New, Male-Specific Microsatellite Markers from the human Y chromosome. Genomics. 57:433-437.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
