Click on a specific marker to view details
GGAAT1B07
GGAAT1B07 (CEPH 1347-01) Example Sequence:
CATTAACCATAGCATTTCT/TTCCA/TTCCA/TTCCA/TTCCA/TTCCA/TT
CCA/TTCCA/TTCCA/TTCCA/TTCCA/TTCCA/TTTCA/TTCCA/TTCCA/
CTGCACTCCGATCCACTCTTCTGAACTCCACTATACTCCACTCTGCTCTAGA
TATTTCCATTCCGTTCCATTCCGTTGCGTTGCAGTCCATTCCACTCTACTTC
11 repeats 193 bp (TTCCA)11 (TTTCA)1 (TTCCA)2 Gene Diversity: 0.61797
| Alleles | Samples | Frequency | Percentage |
|---|
| 3 | 1 | 0.00003 | 0.003% | | 6 | 1 | 0.00003 | 0.003% | | 7 | 7 | 0.00023 | 0.023% | | 8 | 193 | 0.00630 | 0.630% | | 9 | 2522 | 0.08238 | 8.238% | | 10 | 14607 | 0.47715 | 47.715% | | 10-12 | 1 | 0.00003 | 0.003% | | 11 | 11700 | 0.38219 | 38.219% | | 12 | 1103 | 0.03603 | 3.603% | | 13 | 412 | 0.01346 | 1.346% | | 14 | 47 | 0.00154 | 0.154% | | 15 | 18 | 0.00059 | 0.059% | | 16 | 1 | 0.00003 | 0.003% | | Grand Total | 30613 | 1 | 100% |
Missing Data: 2511
Scientific Reference: Yuan, Bo, D. Vaske, J. Weber, J. Beck, V. Sheffield. 1997. Improved Set of Short-tandem-repeat polymorphisms for screening the human genome. Am. J. Hum. Genet. 60:459-460.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
|