Click on a specific marker to view details
DYS463
DYS463 (CEPH 1333-01) Example Sequence:
AATTCTAGGTTTGAGCAAAGACATGTACCACCTTTCACAGCAAATTCTAATTTACA
CTGATGTAGACTAAGAGCCACAGAGCTTGATCAACCATGAAGAAAG/AAAGG/AAA
GG/AAAGG/AAAGG/AAAGG/AAAGG/AAAGG/AAGGG/AAGGG/AAGGG/AAGGG
/AAGGG/AAGGG/AAGGG/AAGGG/AAGGG/AAGGG/AAGGG/AAGGG/AAGGG/A
AGGG/AAGGG/AAGGA/AAGGA/AAAGAGGAGTCAGTCAAGTCACACAACCTCAT
24 repeats 254 bp (AAAGG)7 (AAGGG)15 (AAGGA)2 Gene Diversity: 0.75010
| Alleles | Samples | Frequency | Percentage |
|---|
| 16 | 1 | 0.00003 | 0.003% | | 17 | 27 | 0.00086 | 0.086% | | 18 | 1069 | 0.03398 | 3.398% | | 19 | 249 | 0.00791 | 0.791% | | 20 | 3940 | 0.12523 | 12.523% | | 21 | 4187 | 0.13308 | 13.308% | | 22 | 3976 | 0.12637 | 12.637% | | 23 | 2655 | 0.08439 | 8.439% | | 24 | 13716 | 0.43595 | 43.595% | | 24-27 | 1 | 0.00003 | 0.003% | | 25 | 1454 | 0.04621 | 4.621% | | 26 | 173 | 0.00550 | 0.550% | | 27 | 13 | 0.00041 | 0.041% | | 28 | 1 | 0.00003 | 0.003% | | Grand Total | 31462 | 1 | 100% |
Missing Data: 4730
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int. 130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
