Click on a specific marker to view details
DYS462
DYS462 (CEPH 1333-01) Example Sequence:
TGTGCTGTACCAGTTGCCTATGAGAATTGCTTGTGACAACTTAGGCCTGTTCCAGGCTAAAATTT
TTCCAAATTTTTGTAAACCATCCCAGGCTACATTT/TATG/TATG/TATG/TATG/TATG/TATG
/TATG/TATG/TATG/TATG/TATG/TATTTAGAGACAGGGTTTTACTCTCTTGCTCAGGCTGG
11 repeats 182 bp (TATG)11 Gene Diversity: 0.56022
| Alleles | Samples | Frequency | Percentage |
|---|
| 8 | 42 | 0.00137 | 0.137% | | 9 | 12 | 0.00039 | 0.039% | | 10 | 272 | 0.00888 | 0.888% | | 11 | 16532 | 0.53979 | 53.979% | | 12 | 11605 | 0.37891 | 37.891% | | 13 | 2115 | 0.06906 | 6.906% | | 14 | 49 | 0.00160 | 0.160% | | Grand Total | 30627 | 1 | 100% |
Missing Data: 2497
Scientific Reference: Bosch, Elena, A. Lee, F. Calafell, E. Arroyo, P. Henneman, P. de Knijff, M. Jobling. 2002. High Resolution Y chromosome typing: 19 STRs amplified in three multiplex reactions. Forensic Sci. Int. 125:42-51.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
