Click on a specific marker to view details
DYS461
(Y-GATA-A7.2)
DYS461 (Y-GATA-A7.2) (CEPH 1328-01) Example Sequence:
AGGCAGAGGATAGATGATATGGATAGACAGATATATCTAATAGGTAGATGATAGATAATAGGTAG
ATAGAAGATAGG/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TA
GA/CAGA/TAAGAGAGAAACAGAAATATAGTGACAGCAACTCACTACTGGACAGATTTACCTGAA
12 repeats 182 bp (TAGA)11 (CAGA)1 Gene Diversity: 0.55830
| Alleles | Samples | Frequency | Percentage |
|---|
| 8 | 3 | 0.00009 | 0.009% | | 9 | 48 | 0.00143 | 0.143% | | 10 | 388 | 0.01159 | 1.159% | | 11 | 5697 | 0.17018 | 17.018% | | 11-12 | 1 | 0.00003 | 0.003% | | 11-13 | 2 | 0.00006 | 0.006% | | 12 | 20632 | 0.61630 | 61.630% | | 12-13 | 5 | 0.00015 | 0.015% | | 12-14 | 2 | 0.00006 | 0.006% | | 13 | 6027 | 0.18003 | 18.003% | | 13-14 | 1 | 0.00003 | 0.003% | | 14 | 647 | 0.01933 | 1.933% | | 15 | 24 | 0.00072 | 0.072% | | Grand Total | 33477 | 1 | 100% |
Missing Data: 2715
Scientific Reference: White, P. Scott, O. Tatum, L. Deaven, J. Longmire. 1999. New, Male-Specific Microsatellite Markers from the human Y chromosome. Genomics. 57:433-437.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
