Click on a specific marker to view details
DYS460
(Y-GATA-A7.1)
DYS460 (Y-GATA-A7.1) (CEPH 1329-01) Example Sequence:
GAGGAATCTGACACCTCTGAC/ATAG/ATAG/ATAG/ATAG
/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAATAGACA
AATACATAATAAATGATAGGCAGAGGATAGATGATATGGAC
10 repeats 112 bp (ATAG)10 Gene Diversity: 0.57345
| Alleles | Samples | Frequency | Percentage |
|---|
| 7 | 45 | 0.00137 | 0.137% | | 8 | 18 | 0.00055 | 0.055% | | 9 | 1303 | 0.03964 | 3.964% | | 10 | 11762 | 0.35784 | 35.784% | | 10-11 | 2 | 0.00006 | 0.006% | | 10.1 | 1 | 0.00003 | 0.003% | | 11 | 17816 | 0.54203 | 54.203% | | 11-13 | 2 | 0.00006 | 0.006% | | 12 | 1841 | 0.05601 | 5.601% | | 13 | 79 | 0.00240 | 0.240% | | Grand Total | 32869 | 1 | 100% |
Missing Data: 3323
Scientific Reference: White, P. Scott, O. Tatum, L. Deaven, J. Longmire. 1999. New, Male-Specific Microsatellite Markers from the human Y chromosome. Genomics. 57:433-437. Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
