Click on a specific marker to view details
DYS459 (CEPH 1331-01) Example Sequence:
TTGAGCAACAGAGCAAGACTTAATCACACCCCACTGCAGGCCAAAAATAGG/T
AAA/TAAA/TAAA/TAAA/TAAA/TAAA/TAAA/TAAA/TAAA/TAAGAAAAA
AGGATCAAATTAACTGCAAATATATCAGGTATTATTTACCCCAGTTCACCTG
9 repeats 148 bp (TAAA)9 Gene Diversity: 0.61209
| Haplotype | Samples | Frequency | Percentage |
|---|
| 5-9 | 3 | 0.00009 | 0.009% | | 6-8 | 1 | 0.00003 | 0.003% | | 6-9 | 7 | 0.00021 | 0.021% | | 6-10 | 4 | 0.00012 | 0.012% | | 7-7 | 7 | 0.00021 | 0.021% | | 7-8 | 17 | 0.00050 | 0.050% | | 7-9 | 226 | 0.00669 | 0.669% | | 7-10 | 65 | 0.00192 | 0.192% | | 7-11 | 1 | 0.00003 | 0.003% | | 8-8 | 1040 | 0.03077 | 3.077% | | 8-9 | 5775 | 0.17087 | 17.087% | | 8-9-10 | 2 | 0.00006 | 0.006% | | 8-10 | 4420 | 0.13078 | 13.078% | | 8-11 | 26 | 0.00077 | 0.077% | | 9-9 | 7707 | 0.22803 | 22.803% | | 9-10 | 13605 | 0.40254 | 40.254% | | 9-11 | 146 | 0.00432 | 0.432% | | 9-12 | 1 | 0.00003 | 0.003% | | 10-10 | 733 | 0.02169 | 2.169% | | 10-11 | 10 | 0.00030 | 0.030% | | 11-11 | 2 | 0.00006 | 0.006% | | Grand Total | 33798 | 1 | 100% |
Missing Data: 2394 | Alleles | Samples | Frequency | Percentage |
|---|
| 5 | 3 | 0.00004 | 0.004% | | 6 | 12 | 0.00018 | 0.018% | | 7 | 323 | 0.00478 | 0.478% | | 8 | 12321 | 0.18227 | 18.227% | | 9 | 35179 | 0.52041 | 52.041% | | 10 | 19572 | 0.28954 | 28.954% | | 11 | 187 | 0.00277 | 0.277% | | 12 | 1 | 0.00001 | 0.001% | | Grand Total | 67598 | 1 | 100% |
Missing Data: 4788
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
Explanation of Duplicate Markers
Markers DYS385, DYS459, and YCAII are called "duplicate markers" since two values are present for each marker. At this time, it is not possible to determine the exact order of the two values for these markers.
We combine the two values for duplicated markers into a single value (e.g 11-12) for matching and for TMRCA calculations. However, the exact order might be 11-12 for one individual and 12-11 for another, yet both would be counted as a match.
| 
