Click on a specific marker to view details
DYS458
DYS458 (CEPH 1331-01) Example Sequence:
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GA
AA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/G
AAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTGG
17 repeats 127 bp (GAAA)17 Gene Diversity: 0.78124
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 1 | 0.00003 | 0.003% | | 10 | 1 | 0.00003 | 0.003% | | 12 | 18 | 0.00049 | 0.049% | | 12.2 | 4 | 0.00011 | 0.011% | | 13 | 79 | 0.00215 | 0.215% | | 14 | 1049 | 0.02857 | 2.857% | | 14.2 | 2 | 0.00005 | 0.005% | | 15 | 6311 | 0.17187 | 17.187% | | 15-16 | 1 | 0.00003 | 0.003% | | 15.1 | 1 | 0.00003 | 0.003% | | 15.2 | 5 | 0.00014 | 0.014% | | 16 | 8821 | 0.24023 | 24.023% | | 16-17 | 2 | 0.00005 | 0.005% | | 16.1 | 3 | 0.00008 | 0.008% | | 16.2 | 55 | 0.00150 | 0.150% | | 17 | 11808 | 0.32158 | 32.158% | | 17-18 | 3 | 0.00008 | 0.008% | | 17.2 | 195 | 0.00531 | 0.531% | | 18 | 5771 | 0.15717 | 15.717% | | 18.2 | 139 | 0.00379 | 0.379% | | 19 | 1809 | 0.04927 | 4.927% | | 19.2 | 95 | 0.00259 | 0.259% | | 20 | 388 | 0.01057 | 1.057% | | 20.2 | 34 | 0.00093 | 0.093% | | 21 | 101 | 0.00275 | 0.275% | | 21.2 | 8 | 0.00022 | 0.022% | | 22 | 13 | 0.00035 | 0.035% | | 22.2 | 1 | 0.00003 | 0.003% | | 23 | 1 | 0.00003 | 0.003% | | Grand Total | 36719 | 1 | 100% |
Missing Data: 2474
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
