Click on a specific marker to view details
DYS458
DYS458 (CEPH 1331-01) Example Sequence:
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GA
AA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/G
AAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTGG
17 repeats 127 bp (GAAA)17 Gene Diversity: 0.78058
| Alleles | Samples | Frequency | Percentage |
|---|
| 10 | 1 | 0.00003 | 0.003% | | 12 | 17 | 0.00050 | 0.050% | | 12.2 | 2 | 0.00006 | 0.006% | | 13 | 78 | 0.00231 | 0.231% | | 14 | 960 | 0.02846 | 2.846% | | 14.2 | 1 | 0.00003 | 0.003% | | 15 | 5712 | 0.16936 | 16.936% | | 15-16 | 1 | 0.00003 | 0.003% | | 15.2 | 5 | 0.00015 | 0.015% | | 16 | 8160 | 0.24195 | 24.195% | | 16-17 | 1 | 0.00003 | 0.003% | | 16.1 | 2 | 0.00006 | 0.006% | | 16.2 | 46 | 0.00136 | 0.136% | | 17 | 10871 | 0.32233 | 32.233% | | 17-18 | 3 | 0.00009 | 0.009% | | 17.2 | 182 | 0.00540 | 0.540% | | 18 | 5317 | 0.15765 | 15.765% | | 18.2 | 117 | 0.00347 | 0.347% | | 19 | 1678 | 0.04975 | 4.975% | | 19.2 | 79 | 0.00234 | 0.234% | | 20 | 362 | 0.01073 | 1.073% | | 20.2 | 21 | 0.00062 | 0.062% | | 21 | 95 | 0.00282 | 0.282% | | 21.2 | 4 | 0.00012 | 0.012% | | 22 | 10 | 0.00030 | 0.030% | | 23 | 1 | 0.00003 | 0.003% | | Grand Total | 33726 | 1 | 100% |
Missing Data: 2466
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
