Click on a specific marker to view details
DYS458
DYS458 (CEPH 1331-01) Example Sequence:
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GA
AA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/G
AAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTGG
17 repeats 127 bp (GAAA)17 Gene Diversity: 0.78005
| Alleles | Samples | Frequency | Percentage |
|---|
| 10 | 1 | 0.00003 | 0.003% | | 12 | 15 | 0.00050 | 0.050% | | 12.2 | 2 | 0.00007 | 0.007% | | 13 | 69 | 0.00228 | 0.228% | | 14 | 874 | 0.02887 | 2.887% | | 14.2 | 1 | 0.00003 | 0.003% | | 15 | 5090 | 0.16815 | 16.815% | | 15-16 | 1 | 0.00003 | 0.003% | | 15.2 | 3 | 0.00010 | 0.010% | | 16 | 7342 | 0.24255 | 24.255% | | 16-17 | 1 | 0.00003 | 0.003% | | 16.1 | 2 | 0.00007 | 0.007% | | 16.2 | 42 | 0.00139 | 0.139% | | 17 | 9786 | 0.32329 | 32.329% | | 17-18 | 3 | 0.00010 | 0.010% | | 17.2 | 152 | 0.00502 | 0.502% | | 18 | 4783 | 0.15801 | 15.801% | | 18.2 | 109 | 0.00360 | 0.360% | | 19 | 1477 | 0.04879 | 4.879% | | 19.2 | 73 | 0.00241 | 0.241% | | 20 | 325 | 0.01074 | 1.074% | | 20.2 | 20 | 0.00066 | 0.066% | | 21 | 86 | 0.00284 | 0.284% | | 21.2 | 3 | 0.00010 | 0.010% | | 22 | 9 | 0.00030 | 0.030% | | 23 | 1 | 0.00003 | 0.003% | | Grand Total | 30270 | 1 | 100% |
Missing Data: 2854
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
