Click on a specific marker to view details
DYS456
DYS456 (CEPH 1328-01) Example Sequence:
GGACCTTGTGATAATGTA/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/A
GAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATTCCATTAGTTCTGT
CCCTCTAGAGAACCCTAATACATCAGTTTAAGAAGTTTTGGGCTGAGTTGATGGG
15 repeats 149 bp (AGAT)15 Gene Diversity: 0.70867
| Alleles | Samples | Frequency | Percentage |
|---|
| 11 | 8 | 0.00026 | 0.026% | | 12 | 55 | 0.00180 | 0.180% | | 13 | 564 | 0.01844 | 1.844% | | 14 | 4316 | 0.14113 | 14.113% | | 14-16 | 1 | 0.00003 | 0.003% | | 15 | 12884 | 0.42129 | 42.129% | | 16 | 8626 | 0.28206 | 28.206% | | 17 | 3589 | 0.11736 | 11.736% | | 18 | 501 | 0.01638 | 1.638% | | 19 | 34 | 0.00111 | 0.111% | | 20 | 4 | 0.00013 | 0.013% | | Grand Total | 30582 | 1 | 100% |
Missing Data: 2542
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
