Click on a specific marker to view details
DYS456
DYS456 (CEPH 1328-01) Example Sequence:
GGACCTTGTGATAATGTA/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/A
GAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATTCCATTAGTTCTGT
CCCTCTAGAGAACCCTAATACATCAGTTTAAGAAGTTTTGGGCTGAGTTGATGGG
15 repeats 149 bp (AGAT)15 Gene Diversity: 0.70934
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 5 | 0.00014 | 0.014% | | 11 | 10 | 0.00027 | 0.027% | | 12 | 75 | 0.00204 | 0.204% | | 13 | 708 | 0.01922 | 1.922% | | 14 | 5149 | 0.13980 | 13.980% | | 14-16 | 1 | 0.00003 | 0.003% | | 15 | 15436 | 0.41909 | 41.909% | | 16 | 10500 | 0.28508 | 28.508% | | 16-17 | 1 | 0.00003 | 0.003% | | 16.1 | 1 | 0.00003 | 0.003% | | 17 | 4293 | 0.11656 | 11.656% | | 18 | 607 | 0.01648 | 1.648% | | 19 | 41 | 0.00111 | 0.111% | | 20 | 5 | 0.00014 | 0.014% | | Grand Total | 36832 | 1 | 100% |
Missing Data: 2361
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
