Click on a specific marker to view details
DYS456
DYS456 (CEPH 1328-01) Example Sequence:
GGACCTTGTGATAATGTA/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/A
GAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ATTCCATTAGTTCTGT
CCCTCTAGAGAACCCTAATACATCAGTTTAAGAAGTTTTGGGCTGAGTTGATGGG
15 repeats 149 bp (AGAT)15 Gene Diversity: 0.70833
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 1 | 0.00003 | 0.003% | | 11 | 10 | 0.00029 | 0.029% | | 12 | 59 | 0.00174 | 0.174% | | 13 | 629 | 0.01854 | 1.854% | | 14 | 4736 | 0.13960 | 13.960% | | 14-16 | 1 | 0.00003 | 0.003% | | 15 | 14272 | 0.42069 | 42.069% | | 16 | 9651 | 0.28448 | 28.448% | | 16-17 | 1 | 0.00003 | 0.003% | | 17 | 3967 | 0.11693 | 11.693% | | 18 | 555 | 0.01636 | 1.636% | | 19 | 38 | 0.00112 | 0.112% | | 20 | 5 | 0.00015 | 0.015% | | Grand Total | 33925 | 1 | 100% |
Missing Data: 2267
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
