Click on a specific marker to view details
DYS455
DYS455 (CEPH 1333-01) Example Sequence:
CTGAGCCGAGAGAATGATACTGCCTAAGCCCACAAGGTCAAGGCTGCAGTGAGCTGTGATCACC
CGAGGGCACTCCAGCCTGGGCAACACTGTGAGACCATATATCTA/AAAT/AAAT/AAAT/AAAT
/AAAT/AAAT/AAAT/AAAT/AAAT/AAAT/AAAT/AACGGAAGAACACTCGTTTCCACCCC
11 repeats 178 bp (AAAT)11 Gene Diversity: 0.23661
| Alleles | Samples | Frequency | Percentage |
|---|
| 7 | 16 | 0.00053 | 0.053% | | 8 | 2779 | 0.09199 | 9.199% | | 9 | 82 | 0.00271 | 0.271% | | 10 | 782 | 0.02589 | 2.589% | | 11 | 26235 | 0.86842 | 86.842% | | 12 | 299 | 0.00990 | 0.990% | | 13 | 17 | 0.00056 | 0.056% | | Grand Total | 30210 | 1 | 100% |
Missing Data: 2914
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contreras, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic values of 14 Novel STRs on the human Y chromosome. Forensic Sci. Int. 130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
