Click on a specific marker to view details
DYS455
DYS455 (CEPH 1333-01) Example Sequence:
CTGAGCCGAGAGAATGATACTGCCTAAGCCCACAAGGTCAAGGCTGCAGTGAGCTGTGATCACC
CGAGGGCACTCCAGCCTGGGCAACACTGTGAGACCATATATCTA/AAAT/AAAT/AAAT/AAAT
/AAAT/AAAT/AAAT/AAAT/AAAT/AAAT/AAAT/AACGGAAGAACACTCGTTTCCACCCC
11 repeats 178 bp (AAAT)11 Gene Diversity: 0.23686
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 3 | 0.00009 | 0.009% | | 7 | 18 | 0.00053 | 0.053% | | 8 | 3095 | 0.09197 | 9.197% | | 9 | 129 | 0.00383 | 0.383% | | 10 | 834 | 0.02478 | 2.478% | | 11 | 29222 | 0.86831 | 86.831% | | 12 | 335 | 0.00995 | 0.995% | | 13 | 18 | 0.00053 | 0.053% | | Grand Total | 33654 | 1 | 100% |
Missing Data: 2538
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contreras, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic values of 14 Novel STRs on the human Y chromosome. Forensic Sci. Int. 130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
