Click on a specific marker to view details
DYS454
DYS454 (CEPH 1333-01) Example Sequence:
GACTGACCTCACATTGTTGTTAAGCCCAGCAACATATCACAATCTCCCTGTGG
TCGGGGCACAGGCAAAAGCA/AAAT/AAAT/AAAT/AAAT/AAAT/AAAT/AA
AT/AAAT/AAAT/AAAT/AAAT/AACCTAGGTGCTAATCCAAGTGATATGTTA
CAATGTTTCCTGTTGACACAACCCAACCTGGGTGAAGTGAAGAGCTACATGTC
11 repeats 200 bp (AAAT)11 Gene Diversity: 0.15266
| Alleles | Samples | Frequency | Percentage |
|---|
| 6 | 1 | 0.00003 | 0.003% | | 7 | 3 | 0.00010 | 0.010% | | 8 | 14 | 0.00046 | 0.046% | | 9 | 40 | 0.00132 | 0.132% | | 10 | 126 | 0.00417 | 0.417% | | 10.3 | 3 | 0.00010 | 0.010% | | 11 | 27731 | 0.91773 | 91.773% | | 12 | 2153 | 0.07125 | 7.125% | | 13 | 145 | 0.00480 | 0.480% | | 14 | 1 | 0.00003 | 0.003% | | Grand Total | 30217 | 1 | 100% |
Missing Data: 2907
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contreras, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic values of 14 Novel STRs on the human Y chromosome. Forensic Sci. Int. 130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
