Click on a specific marker to view details
DYS452
DYS452 (CEPH 1331-01) Example Sequence:
GTGGTGTTCTGATGAGGATAATT/TATAC/TATAC/TGTAC/TGTAC/TATAC/TATA
C/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/CA
TAC/TATAC/CATAC/TATAC/TATAC/TATAC/CATAC/CATAC/TATAC/TATAC/
TATAC/CATAC/TATAC/TATAC/TATAC/AACCAATTAATTAGCTGAGTATAATAAA
30 repeats 201 bp (TATAC)2 (TGTAC)2 (TATAC)11 (CATAC)1 (TATAC)1 (CATAC)1 (TATAC)3 (CATAC)2 (TATAC)3 (CATAC)1 (TATAC)3 Gene Diversity: 0.62587
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 2 | 0.00006 | 0.006% | | 24 | 17 | 0.00053 | 0.053% | | 25 | 107 | 0.00331 | 0.331% | | 26 | 324 | 0.01002 | 1.002% | | 27 | 265 | 0.00820 | 0.820% | | 28 | 266 | 0.00823 | 0.823% | | 29 | 2487 | 0.07693 | 7.693% | | 30 | 17239 | 0.53329 | 53.329% | | 30-31 | 1 | 0.00003 | 0.003% | | 31 | 9099 | 0.28148 | 28.148% | | 32 | 2099 | 0.06493 | 6.493% | | 33 | 394 | 0.01219 | 1.219% | | 34 | 24 | 0.00074 | 0.074% | | 35 | 2 | 0.00006 | 0.006% | | Grand Total | 32326 | 1 | 100% |
Missing Data: 3866
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
