Click on a specific marker to view details
DYS452
DYS452 (CEPH 1331-01) Example Sequence:
GTGGTGTTCTGATGAGGATAATT/TATAC/TATAC/TGTAC/TGTAC/TATAC/TATA
C/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/TATAC/CA
TAC/TATAC/CATAC/TATAC/TATAC/TATAC/CATAC/CATAC/TATAC/TATAC/
TATAC/CATAC/TATAC/TATAC/TATAC/AACCAATTAATTAGCTGAGTATAATAAA
30 repeats 201 bp (TATAC)2 (TGTAC)2 (TATAC)11 (CATAC)1 (TATAC)1 (CATAC)1 (TATAC)3 (CATAC)2 (TATAC)3 (CATAC)1 (TATAC)3 Gene Diversity: 0.62307
| Alleles | Samples | Frequency | Percentage |
|---|
| 24 | 16 | 0.00055 | 0.055% | | 25 | 98 | 0.00334 | 0.334% | | 26 | 294 | 0.01003 | 1.003% | | 27 | 238 | 0.00812 | 0.812% | | 28 | 240 | 0.00819 | 0.819% | | 29 | 2241 | 0.07647 | 7.647% | | 30 | 15756 | 0.53762 | 53.762% | | 30-31 | 1 | 0.00003 | 0.003% | | 31 | 8164 | 0.27857 | 27.857% | | 32 | 1868 | 0.06374 | 6.374% | | 33 | 369 | 0.01259 | 1.259% | | 34 | 20 | 0.00068 | 0.068% | | 35 | 2 | 0.00007 | 0.007% | | Grand Total | 29307 | 1 | 100% |
Missing Data: 3817
Scientific Reference: Redd, Alan J., A. Agellon, V. Kearney, V. Contrearas, T. Karafet, H. Park, P. de Knijff, J. Butler, M. Hammer. 2002. Forensic value of 14 novel STRs on the human Y chromosome. Forensic Sci. Int.130:97-111.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
