Click on a specific marker to view details
DYS448
DYS448 (CEPH 1451-01) Example Sequence:
TGGGAGAGGCAAGGATCCAAATAAAGAACAGAGAAGTGTCAAAGAGCTTCAATGGA
GATTAGAAATAGAGATCGCGAGACAGAAAGGGAGATAGAGACATGGATAA/AGAGA
T/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGA
T/AGAGAT/AGAGAT/ATAGAGATAGAGAGATAGAGATAGAGATAGATAGATAGAG
AA/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAG
AT/AGAGAGGTAAAGATAGAGATAAATTTCCAGACCGGCCAGAAATATGAC
19 repeats 310 bp (AGAGAT)11 (N)42 (AGAGAT)8 Gene Diversity: 0.69303
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 1 | 0.00003 | 0.003% | | 14 | 1 | 0.00003 | 0.003% | | 15 | 8 | 0.00024 | 0.024% | | 16 | 21 | 0.00064 | 0.064% | | 16.2 | 1 | 0.00003 | 0.003% | | 17 | 193 | 0.00584 | 0.584% | | 17.2 | 1 | 0.00003 | 0.003% | | 17.4 | 3 | 0.00009 | 0.009% | | 18 | 2707 | 0.08190 | 8.190% | | 18-19 | 1 | 0.00003 | 0.003% | | 18.2 | 7 | 0.00021 | 0.021% | | 18.4 | 6 | 0.00018 | 0.018% | | 19 | 14283 | 0.43211 | 43.211% | | 19-20 | 27 | 0.00082 | 0.082% | | 19.2 | 18 | 0.00054 | 0.054% | | 20 | 9847 | 0.29791 | 29.791% | | 20-22 | 1 | 0.00003 | 0.003% | | 20.2 | 2 | 0.00006 | 0.006% | | 20.4 | 2 | 0.00006 | 0.006% | | 21 | 5162 | 0.15617 | 15.617% | | 21.5 | 1 | 0.00003 | 0.003% | | 22 | 646 | 0.01954 | 1.954% | | 23 | 109 | 0.00330 | 0.330% | | 24 | 6 | 0.00018 | 0.018% | | Grand Total | 33054 | 1 | 100% |
Missing Data: 3138
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
