Click on a specific marker to view details
DYS448
DYS448 (CEPH 1451-01) Example Sequence:
TGGGAGAGGCAAGGATCCAAATAAAGAACAGAGAAGTGTCAAAGAGCTTCAATGGA
GATTAGAAATAGAGATCGCGAGACAGAAAGGGAGATAGAGACATGGATAA/AGAGA
T/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGA
T/AGAGAT/AGAGAT/ATAGAGATAGAGAGATAGAGATAGAGATAGATAGATAGAG
AA/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAGAT/AGAG
AT/AGAGAGGTAAAGATAGAGATAAATTTCCAGACCGGCCAGAAATATGAC
19 repeats 310 bp (AGAGAT)11 (N)42 (AGAGAT)8 Gene Diversity: 0.68957
| Alleles | Samples | Frequency | Percentage |
|---|
| 14 | 1 | 0.00003 | 0.003% | | 15 | 7 | 0.00023 | 0.023% | | 16 | 18 | 0.00060 | 0.060% | | 16.2 | 1 | 0.00003 | 0.003% | | 17 | 177 | 0.00587 | 0.587% | | 17.2 | 1 | 0.00003 | 0.003% | | 17.4 | 3 | 0.00010 | 0.010% | | 18 | 2474 | 0.08200 | 8.200% | | 18.2 | 6 | 0.00020 | 0.020% | | 18.4 | 6 | 0.00020 | 0.020% | | 19 | 13160 | 0.43617 | 43.617% | | 19-20 | 26 | 0.00086 | 0.086% | | 19.2 | 18 | 0.00060 | 0.060% | | 20 | 9102 | 0.30167 | 30.167% | | 20-22 | 1 | 0.00003 | 0.003% | | 20.2 | 1 | 0.00003 | 0.003% | | 20.4 | 2 | 0.00007 | 0.007% | | 21 | 4483 | 0.14858 | 14.858% | | 21.5 | 1 | 0.00003 | 0.003% | | 22 | 574 | 0.01902 | 1.902% | | 23 | 104 | 0.00345 | 0.345% | | 24 | 6 | 0.00020 | 0.020% | | Grand Total | 30172 | 1 | 100% |
Missing Data: 2952
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
