Click on a specific marker to view details
DYS447
DYS447 (CEPH 1333-01) Example Sequence:
GGTCACAGCATGGCTTGGTTTTATACATTTTAGGGAGACATAAGGCAT/TAATA/TAATA/
TAATA/TAATA/TAATA/TAATA/TAATA/TAAAA/TAATA/TAATA/TAATA/TAATA/T
AATA/TAATA/TAATA/TAATA/TAATA/TAAAA/TAATA/TAATA/TAATA/TAATA/TA
ATA/TAATA/TAAACATTAGTTCTGTCCAGAAAGGCAGAGATAACGCAAAGCAAGCCC
24 repeats 216 bp (TAATA)7 (TAAAA)1 (TAATA)9 (TAAAA)1 (TAATA)6 Gene Diversity: 0.73773
| Alleles | Samples | Frequency | Percentage |
|---|
| 14 | 2 | 0.00007 | 0.007% | | 15 | 4 | 0.00014 | 0.014% | | 16 | 3 | 0.00011 | 0.011% | | 17 | 6 | 0.00021 | 0.021% | | 18 | 16 | 0.00056 | 0.056% | | 19 | 39 | 0.00137 | 0.137% | | 20 | 36 | 0.00126 | 0.126% | | 21 | 133 | 0.00467 | 0.467% | | 22 | 856 | 0.03006 | 3.006% | | 22.2 | 3 | 0.00011 | 0.011% | | 22.4 | 23 | 0.00081 | 0.081% | | 23 | 3674 | 0.12901 | 12.901% | | 24 | 4492 | 0.15774 | 15.774% | | 25 | 12494 | 0.43872 | 43.872% | | 26 | 4292 | 0.15071 | 15.071% | | 26.4 | 1 | 0.00004 | 0.004% | | 27 | 1905 | 0.06689 | 6.689% | | 28 | 355 | 0.01247 | 1.247% | | 29 | 120 | 0.00421 | 0.421% | | 30 | 14 | 0.00049 | 0.049% | | 31 | 4 | 0.00014 | 0.014% | | 32 | 1 | 0.00004 | 0.004% | | 33 | 3 | 0.00011 | 0.011% | | 34 | 1 | 0.00004 | 0.004% | | 36 | 1 | 0.00004 | 0.004% | | Grand Total | 28478 | 1 | 100% |
Missing Data: 4646
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
