Click on a specific marker to view details
DYS447
DYS447 (CEPH 1333-01) Example Sequence:
GGTCACAGCATGGCTTGGTTTTATACATTTTAGGGAGACATAAGGCAT/TAATA/TAATA/
TAATA/TAATA/TAATA/TAATA/TAATA/TAAAA/TAATA/TAATA/TAATA/TAATA/T
AATA/TAATA/TAATA/TAATA/TAATA/TAAAA/TAATA/TAATA/TAATA/TAATA/TA
ATA/TAATA/TAAACATTAGTTCTGTCCAGAAAGGCAGAGATAACGCAAAGCAAGCCC
24 repeats 216 bp (TAATA)7 (TAAAA)1 (TAATA)9 (TAAAA)1 (TAATA)6 Gene Diversity: 0.74089
| Alleles | Samples | Frequency | Percentage |
|---|
| 14 | 3 | 0.00010 | 0.010% | | 15 | 4 | 0.00013 | 0.013% | | 16 | 4 | 0.00013 | 0.013% | | 17 | 11 | 0.00035 | 0.035% | | 18 | 17 | 0.00054 | 0.054% | | 19 | 40 | 0.00128 | 0.128% | | 20 | 38 | 0.00122 | 0.122% | | 21 | 144 | 0.00461 | 0.461% | | 22 | 937 | 0.03000 | 3.000% | | 22.2 | 3 | 0.00010 | 0.010% | | 22.4 | 25 | 0.00080 | 0.080% | | 23 | 4049 | 0.12964 | 12.964% | | 24 | 4915 | 0.15737 | 15.737% | | 25 | 13574 | 0.43462 | 43.462% | | 26 | 4734 | 0.15158 | 15.158% | | 26.4 | 1 | 0.00003 | 0.003% | | 27 | 2102 | 0.06730 | 6.730% | | 28 | 465 | 0.01489 | 1.489% | | 29 | 130 | 0.00416 | 0.416% | | 30 | 15 | 0.00048 | 0.048% | | 31 | 8 | 0.00026 | 0.026% | | 32 | 7 | 0.00022 | 0.022% | | 33 | 4 | 0.00013 | 0.013% | | 34 | 1 | 0.00003 | 0.003% | | 36 | 1 | 0.00003 | 0.003% | | Grand Total | 31232 | 1 | 100% |
Missing Data: 4960
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
