Click on a specific marker to view details
DYS445
DYS445 (CEPH 1333-01) Example Sequence:
AGTTAAGAGCCCCACCTTCCTGGGAGGAGCTGCCGTTGCCCAAATTTTATCTGTGG
ATGAAAGTATCCCTGTGCACTTGGGTAGTTGGGGGCAAGCGAAAGCCCCATTCCCT
AGGGTGCAGCAGCAGCTGCCTACCCGTGGCATCCCTGCACTC/TTTA/TTTA/TTT
A/TTTA/TTTA/TTTA/TTTA/TTTA/TTTA/TTTA/TTTA/TTTA/TTTTTAAGA
CGGAATCTTTCTCTGTTACCCACGTTGGATTTTGGTGGCATAATCTCAGCTC
12 repeats 263 bp (TTTA)12 Gene Diversity: 0.50233
| Alleles | Samples | Frequency | Percentage |
|---|
| 6 | 154 | 0.00504 | 0.504% | | 7 | 5 | 0.00016 | 0.016% | | 8 | 3 | 0.00010 | 0.010% | | 9 | 24 | 0.00079 | 0.079% | | 10 | 2324 | 0.07602 | 7.602% | | 10.1 | 7 | 0.00023 | 0.023% | | 11 | 5674 | 0.18561 | 18.561% | | 11.2 | 1 | 0.00003 | 0.003% | | 12 | 20606 | 0.67406 | 67.406% | | 13 | 1692 | 0.05535 | 5.535% | | 14 | 78 | 0.00255 | 0.255% | | 15 | 2 | 0.00007 | 0.007% | | Grand Total | 30570 | 1 | 100% |
Missing Data: 2554
Scientific Reference: Iida, R., E. Tsubota, K. Sawazaki, M. Masuyama, T. Matsuki, T. Yasuda, K. Kishi. 2002. Characterization and haplotype analysis of the polymorphic Y-STRs DYS443, DYS444 and DYS445 in a Japanese population. Int. J. Legal Med. 116:191-194.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
