Click on a specific marker to view details
DYS444
DYS444 (CEPH 1328-01) Example Sequence:
GTGTGAACCATTTGGCATGTTTATTTTCATTATTTCATTTTCTCTCTTCTCCACTTTAACCAGT
ATACAGAAAGAACTCTAAGTATTAATTTACAATACAACACATGAATTATAGTGCAATAGATATA
TAGGTAGGTAAGTAGGTAGGTAGATACATAGATAGATAA/ATAG/ATAG/ATAG/ATAG/ATAG
/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAAAGTTGACCCTTGAACAACG
TGAGTTTGAATGGCATGGGCTCACTTATATATAGATTTCCTTCTGCCTTTGGATCCCTTAGA
13 repeats 304 bp (ATAG)13 Gene Diversity: 0.63413
| Alleles | Samples | Frequency | Percentage |
|---|
| 8 | 1 | 0.00003 | 0.003% | | 9 | 14 | 0.00046 | 0.046% | | 9.3 | 3 | 0.00010 | 0.010% | | 10 | 279 | 0.00917 | 0.917% | | 11 | 2648 | 0.08706 | 8.706% | | 12 | 16025 | 0.52684 | 52.684% | | 12-13 | 1 | 0.00003 | 0.003% | | 13 | 8089 | 0.26594 | 26.594% | | 14 | 3015 | 0.09912 | 9.912% | | 15 | 331 | 0.01088 | 1.088% | | 16 | 11 | 0.00036 | 0.036% | | Grand Total | 30417 | 1 | 100% |
Missing Data: 2707
Scientific Reference: Iida, R., E. Tsubota, K. Sawazaki, M. Masuyama, T. Matsuki, T. Yasuda, K. Kishi. 2002. Characterization and haplotype analysis of the polymorphic Y-STRs DYS443, DYS444 and DYS445 in a Japanese population. Int. J. Legal Med. 116:191-194.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
