Click on a specific marker to view details
DYS444
DYS444 (CEPH 1328-01) Example Sequence:
GTGTGAACCATTTGGCATGTTTATTTTCATTATTTCATTTTCTCTCTTCTCCACTTTAACCAGT
ATACAGAAAGAACTCTAAGTATTAATTTACAATACAACACATGAATTATAGTGCAATAGATATA
TAGGTAGGTAAGTAGGTAGGTAGATACATAGATAGATAA/ATAG/ATAG/ATAG/ATAG/ATAG
/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAG/ATAAAGTTGACCCTTGAACAACG
TGAGTTTGAATGGCATGGGCTCACTTATATATAGATTTCCTTCTGCCTTTGGATCCCTTAGA
13 repeats 304 bp (ATAG)13 Gene Diversity: 0.63548
| Alleles | Samples | Frequency | Percentage |
|---|
| 8 | 1 | 0.00003 | 0.003% | | 9 | 14 | 0.00042 | 0.042% | | 9.3 | 8 | 0.00024 | 0.024% | | 10 | 339 | 0.01013 | 1.013% | | 11 | 2922 | 0.08729 | 8.729% | | 12 | 17578 | 0.52509 | 52.509% | | 12-13 | 1 | 0.00003 | 0.003% | | 13 | 8938 | 0.26700 | 26.700% | | 14 | 3295 | 0.09843 | 9.843% | | 15 | 366 | 0.01093 | 1.093% | | 16 | 14 | 0.00042 | 0.042% | | Grand Total | 33476 | 1 | 100% |
Missing Data: 2716
Scientific Reference: Iida, R., E. Tsubota, K. Sawazaki, M. Masuyama, T. Matsuki, T. Yasuda, K. Kishi. 2002. Characterization and haplotype analysis of the polymorphic Y-STRs DYS443, DYS444 and DYS445 in a Japanese population. Int. J. Legal Med. 116:191-194.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
