Click on a specific marker to view details
DYS442
DYS442 (CEPH 1331-01) Example Sequence:
CCCCAAGTCCCCAAAGTGTGTTGCATCATTCTTATGCCTCTGCATCCTCATAGCTTAGCTCCCA
CATATCAGTGAGAACGTATGATGTTTGGTTTTCCATTCCTGAGTTACTTCATTTAGAATAATAG
CCTCCAATCTCATCCAAGCCACTGCAAATGTCATTAGCTCATTCTTTTTTGTGGCTGAGTAGTA
TTCCATTG/TATC/TATC/TGTC/TGTC/TGTC/TATC/TATC/TATC/TATC/TATC/TATC/
TATC/TATC/TATC/TATC/TATC/ACAGTTTCTTTATCCACTCATTGATTGATGGGCGTTT
16 repeats 301 bp (TATC)2 (TGTC)3 (TATC)11 Gene Diversity: 0.59415
| Alleles | Samples | Frequency | Percentage |
|---|
| 12 | 1 | 0.00003 | 0.003% | | 13 | 54 | 0.00176 | 0.176% | | 14 | 45 | 0.00146 | 0.146% | | 15 | 466 | 0.01517 | 1.517% | | 16 | 8246 | 0.26842 | 26.842% | | 16-18 | 1 | 0.00003 | 0.003% | | 17 | 17400 | 0.56639 | 56.639% | | 17.1 | 2 | 0.00007 | 0.007% | | 18 | 3322 | 0.10813 | 10.813% | | 19 | 1003 | 0.03265 | 3.265% | | 20 | 175 | 0.00570 | 0.570% | | 21 | 6 | 0.00020 | 0.020% | | Grand Total | 30721 | 1 | 100% |
Missing Data: 2403
Scientific Reference: Iida, R., E. Tsubota, T. Matsuki. 2001. Identification and characterization of two novel human polymorphic STRs on the Y chromosome. Int. J. Legal Med. 115:54-56.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
