Click on a specific marker to view details
DYS442
DYS442 (CEPH 1331-01) Example Sequence:
CCCCAAGTCCCCAAAGTGTGTTGCATCATTCTTATGCCTCTGCATCCTCATAGCTTAGCTCCCA
CATATCAGTGAGAACGTATGATGTTTGGTTTTCCATTCCTGAGTTACTTCATTTAGAATAATAG
CCTCCAATCTCATCCAAGCCACTGCAAATGTCATTAGCTCATTCTTTTTTGTGGCTGAGTAGTA
TTCCATTG/TATC/TATC/TGTC/TGTC/TGTC/TATC/TATC/TATC/TATC/TATC/TATC/
TATC/TATC/TATC/TATC/TATC/ACAGTTTCTTTATCCACTCATTGATTGATGGGCGTTT
16 repeats 301 bp (TATC)2 (TGTC)3 (TATC)11 Gene Diversity: 0.59767
| Alleles | Samples | Frequency | Percentage |
|---|
| 12 | 1 | 0.00003 | 0.003% | | 13 | 72 | 0.00213 | 0.213% | | 14 | 47 | 0.00139 | 0.139% | | 15 | 508 | 0.01503 | 1.503% | | 16 | 9290 | 0.27494 | 27.494% | | 16-18 | 1 | 0.00003 | 0.003% | | 17 | 18930 | 0.56024 | 56.024% | | 17.1 | 2 | 0.00006 | 0.006% | | 18 | 3632 | 0.10749 | 10.749% | | 19 | 1100 | 0.03255 | 3.255% | | 20 | 199 | 0.00589 | 0.589% | | 21 | 7 | 0.00021 | 0.021% | | Grand Total | 33789 | 1 | 100% |
Missing Data: 2403
Scientific Reference: Iida, R., E. Tsubota, T. Matsuki. 2001. Identification and characterization of two novel human polymorphic STRs on the Y chromosome. Int. J. Legal Med. 115:54-56.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
|