Click on a specific marker to view details
DYS439
(Y-GATA-A4)
DYS439 (Y-GATA-A4) (CEPH 1328-01) Example Sequence:
TCGAGTTGTTATGGTTTTAGGTCTAACATTTAAGTCTTTAATCTATCTTGAATTAATA
GATTCAAGGTGATAGATATACAGATAGATAGATACATAGGTGGAGACAGATAGATGAT
AAATAGAA/GATA/GATA/GATA/GATA/GATA/GATA/GATA/GATA/GATA/GATA
/GATA/GATA/GAAAGTATAAGTAAAGAGATGATGGGTAAAAGAATTCCAAGCCAC
12 repeats 217 bp (GATA)12 Gene Diversity: 0.67060
| Alleles | Samples | Frequency | Percentage |
|---|
| 8 | 9 | 0.00027 | 0.027% | | 9 | 51 | 0.00153 | 0.153% | | 10 | 2711 | 0.08134 | 8.134% | | 10-11 | 2 | 0.00006 | 0.006% | | 10-12 | 2 | 0.00006 | 0.006% | | 11 | 10867 | 0.32606 | 32.606% | | 11-12 | 4 | 0.00012 | 0.012% | | 12 | 14921 | 0.44770 | 44.770% | | 12-13 | 2 | 0.00006 | 0.006% | | 12-14 | 1 | 0.00003 | 0.003% | | 13 | 4189 | 0.12569 | 12.569% | | 14 | 525 | 0.01575 | 1.575% | | 15 | 42 | 0.00126 | 0.126% | | 16 | 2 | 0.00006 | 0.006% | | Grand Total | 33328 | 1 | 100% |
Missing Data: 2864
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
