Click on a specific marker to view details
DYS437
DYS437 (CEPH 1451-01) Example Sequence:
GACTATGGGCGTGAGTGCATGCCCATCCGG/TCTA/TCTA/TCTA/TCTA/T
CTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTG/TCTA/TCTA/TCTA/TCT
A/TCATCTATCATCTGGGAATGATGTCTATCTACTTATCTATGAATGATATT
TATCTGTGGTTATCTATCTATCTATATCATCTGTGAATGACAGGGTCTC
15 repeats 189 bp (TCTA)9 (TCTG)2 (TCTA)4 Gene Diversity: 0.62147
| Alleles | Samples | Frequency | Percentage |
|---|
| 11 | 1 | 0.00003 | 0.003% | | 12 | 16 | 0.00048 | 0.048% | | 13 | 222 | 0.00665 | 0.665% | | 14 | 13745 | 0.41163 | 41.163% | | 15 | 14538 | 0.43537 | 43.537% | | 15-16 | 2 | 0.00006 | 0.006% | | 15.1 | 3 | 0.00009 | 0.009% | | 16 | 4663 | 0.13964 | 13.964% | | 17 | 138 | 0.00413 | 0.413% | | 18 | 64 | 0.00192 | 0.192% | | Grand Total | 33392 | 1 | 100% |
Missing Data: 2800
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
