Click on a specific marker to view details
DYS437
DYS437 (CEPH 1451-01) Example Sequence:
GACTATGGGCGTGAGTGCATGCCCATCCGG/TCTA/TCTA/TCTA/TCTA/T
CTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTG/TCTA/TCTA/TCTA/TCT
A/TCATCTATCATCTGGGAATGATGTCTATCTACTTATCTATGAATGATATT
TATCTGTGGTTATCTATCTATCTATATCATCTGTGAATGACAGGGTCTC
15 repeats 189 bp (TCTA)9 (TCTG)2 (TCTA)4 Gene Diversity: 0.62121
| Alleles | Samples | Frequency | Percentage |
|---|
| 11 | 1 | 0.00003 | 0.003% | | 12 | 16 | 0.00053 | 0.053% | | 13 | 207 | 0.00682 | 0.682% | | 14 | 12301 | 0.40526 | 40.526% | | 15 | 13409 | 0.44177 | 44.177% | | 15-16 | 2 | 0.00007 | 0.007% | | 15.1 | 3 | 0.00010 | 0.010% | | 16 | 4221 | 0.13906 | 13.906% | | 17 | 129 | 0.00425 | 0.425% | | 18 | 64 | 0.00211 | 0.211% | | Grand Total | 30353 | 1 | 100% |
Missing Data: 2771
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
