Click on a specific marker to view details
DYS426
DYS426 (CEPH 1331-01) Example Sequence:
CTCAAAGTATGAAAGCATGACCACTTCATTTAGTTGT
/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/
GTT/GTT/GTT/GACACAAAGTCTCGTCTTGTCACC
12 repeats 97 bp (GTT)12 Gene Diversity: 0.51074
| Alleles | Samples | Frequency | Percentage |
|---|
| 6.2 | 3 | 0.00009 | 0.009% | | 9 | 6 | 0.00018 | 0.018% | | 10 | 121 | 0.00363 | 0.363% | | 11 | 15186 | 0.45579 | 45.579% | | 12 | 17675 | 0.53049 | 53.049% | | 13 | 314 | 0.00942 | 0.942% | | 14 | 13 | 0.00039 | 0.039% | | Grand Total | 33318 | 1 | 100% |
Missing Data: 2874
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
|