Click on a specific marker to view details
DYS426
DYS426 (CEPH 1331-01) Example Sequence:
CTCAAAGTATGAAAGCATGACCACTTCATTTAGTTGT
/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/GTT/
GTT/GTT/GTT/GACACAAAGTCTCGTCTTGTCACC
12 repeats 97 bp (GTT)12 Gene Diversity: 0.51064
| Alleles | Samples | Frequency | Percentage |
|---|
| 6.2 | 3 | 0.00010 | 0.010% | | 9 | 6 | 0.00020 | 0.020% | | 10 | 111 | 0.00365 | 0.365% | | 11 | 13773 | 0.45257 | 45.257% | | 12 | 16231 | 0.53334 | 53.334% | | 13 | 296 | 0.00973 | 0.973% | | 14 | 13 | 0.00043 | 0.043% | | Grand Total | 30433 | 1 | 100% |
Missing Data: 2691
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
