Click on a specific marker to view details
DYS19
DYS19 (CEPH 1328-01) Example Sequence:
ACTACTGAGTTTCTGTTATAGTGTTTTTTAATATATATATAGTATTATATATA
TAGTGTTATATATATATAGTGTTT/TAGA/TAGA/TAGA/TAGG/TAGA/TAG
A/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TATAGT
GACACTCTCCTTAACCCAGATGGACTCCTTGTCCTCACTACATGGCCATGGCC
CGAAGTATTACTCCTGGTGCCCCAGCCACTATTTCCAGGTGCAGAGATTGAC
14 repeats 248 bp (TAGA)3 tagg (TAGA)11 Gene Diversity: 0.64088
| Alleles | Samples | Frequency | Percentage |
|---|
| 9 | 1 | 0.00003 | 0.003% | | 10 | 1 | 0.00003 | 0.003% | | 11 | 4 | 0.00013 | 0.013% | | 12 | 32 | 0.00104 | 0.104% | | 12-15 | 5 | 0.00016 | 0.016% | | 13 | 2468 | 0.08004 | 8.004% | | 13-15 | 2 | 0.00006 | 0.006% | | 13.2 | 1 | 0.00003 | 0.003% | | 14 | 16440 | 0.53316 | 53.316% | | 14-15 | 5 | 0.00016 | 0.016% | | 14-17 | 3 | 0.00010 | 0.010% | | 14.2 | 1 | 0.00003 | 0.003% | | 15 | 7297 | 0.23665 | 23.665% | | 15-16 | 13 | 0.00042 | 0.042% | | 15-17 | 8 | 0.00026 | 0.026% | | 16 | 3237 | 0.10498 | 10.498% | | 16-17 | 127 | 0.00412 | 0.412% | | 16-18 | 1 | 0.00003 | 0.003% | | 17 | 1168 | 0.03788 | 3.788% | | 18 | 21 | 0.00068 | 0.068% | | Grand Total | 30835 | 1 | 100% |
Missing Data: 2289
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
