Click on a specific marker to view details
DYS19
DYS19 (CEPH 1328-01) Example Sequence:
ACTACTGAGTTTCTGTTATAGTGTTTTTTAATATATATATAGTATTATATATA
TAGTGTTATATATATATAGTGTTT/TAGA/TAGA/TAGA/TAGG/TAGA/TAG
A/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TATAGT
GACACTCTCCTTAACCCAGATGGACTCCTTGTCCTCACTACATGGCCATGGCC
CGAAGTATTACTCCTGGTGCCCCAGCCACTATTTCCAGGTGCAGAGATTGAC
14 repeats 248 bp (TAGA)3 tagg (TAGA)11 Gene Diversity: 0.64485
| Alleles | Samples | Frequency | Percentage |
|---|
| 9 | 2 | 0.00006 | 0.006% | | 10 | 1 | 0.00003 | 0.003% | | 11 | 5 | 0.00015 | 0.015% | | 12 | 36 | 0.00107 | 0.107% | | 12-15 | 5 | 0.00015 | 0.015% | | 13 | 2616 | 0.07764 | 7.764% | | 13-15 | 2 | 0.00006 | 0.006% | | 13.2 | 1 | 0.00003 | 0.003% | | 14 | 17767 | 0.52732 | 52.732% | | 14-15 | 5 | 0.00015 | 0.015% | | 14-17 | 3 | 0.00009 | 0.009% | | 14.2 | 1 | 0.00003 | 0.003% | | 15 | 8115 | 0.24085 | 24.085% | | 15-16 | 14 | 0.00042 | 0.042% | | 15-17 | 8 | 0.00024 | 0.024% | | 16 | 3607 | 0.10705 | 10.705% | | 16-17 | 132 | 0.00392 | 0.392% | | 16-18 | 1 | 0.00003 | 0.003% | | 17 | 1343 | 0.03986 | 3.986% | | 18 | 28 | 0.00083 | 0.083% | | 19 | 1 | 0.00003 | 0.003% | | Grand Total | 33693 | 1 | 100% |
Missing Data: 2499
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
