Click on a specific marker to view details
DYS393
DYS393 (CEPH 1347-01) Example Sequence:
GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/
AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/
ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC
15 repeats 132 bp (AGAT)15 Gene Diversity: 0.46218
| Alleles | Samples | Frequency | Percentage |
|---|
| 10 | 13 | 0.00039 | 0.039% | | 11 | 92 | 0.00273 | 0.273% | | 12 | 3077 | 0.09124 | 9.124% | | 13 | 23997 | 0.71153 | 71.153% | | 14 | 4900 | 0.14529 | 14.529% | | 15 | 1551 | 0.04599 | 4.599% | | 16 | 93 | 0.00276 | 0.276% | | 17 | 3 | 0.00009 | 0.009% | | Grand Total | 33726 | 1 | 100% |
Missing Data: 2466
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
