Click on a specific marker to view details
DYS393
DYS393 (CEPH 1347-01) Example Sequence:
GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/
AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/
ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC
15 repeats 132 bp (AGAT)15 Gene Diversity: 0.45621
| Alleles | Samples | Frequency | Percentage |
|---|
| 10 | 12 | 0.00040 | 0.040% | | 11 | 83 | 0.00274 | 0.274% | | 12 | 2777 | 0.09173 | 9.173% | | 13 | 21681 | 0.71618 | 71.618% | | 14 | 4343 | 0.14346 | 14.346% | | 15 | 1312 | 0.04334 | 4.334% | | 16 | 63 | 0.00208 | 0.208% | | 17 | 2 | 0.00007 | 0.007% | | Grand Total | 30273 | 1 | 100% |
Missing Data: 2851
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
|