Click on a specific marker to view details
DYS391
DYS391 (CEPH 1358-01) Example Sequence:
TTCATCATACACCCATATCTGTCTGTCTG/TCTA/TCTA/
TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/
TCTA/TCTGCCTATCTGCCTGCCTACCTATCCCTCTATC
11 repeats 107 bp (TCTA)11 Gene Diversity: 0.53511
| Alleles | Samples | Frequency | Percentage |
|---|
| 6 | 17 | 0.00051 | 0.051% | | 7 | 6 | 0.00018 | 0.018% | | 8 | 17 | 0.00051 | 0.051% | | 9 | 1027 | 0.03075 | 3.075% | | 10 | 18715 | 0.56033 | 56.033% | | 11 | 12919 | 0.38680 | 38.680% | | 12 | 646 | 0.01934 | 1.934% | | 13 | 51 | 0.00153 | 0.153% | | 14 | 2 | 0.00006 | 0.006% | | Grand Total | 33400 | 1 | 100% |
Missing Data: 2792
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
