Click on a specific marker to view details
DYS391
DYS391 (CEPH 1358-01) Example Sequence:
TTCATCATACACCCATATCTGTCTGTCTG/TCTA/TCTA/
TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/
TCTA/TCTGCCTATCTGCCTGCCTACCTATCCCTCTATC
11 repeats 107 bp (TCTA)11 Gene Diversity: 0.53614
| Alleles | Samples | Frequency | Percentage |
|---|
| 6 | 17 | 0.00056 | 0.056% | | 7 | 6 | 0.00020 | 0.020% | | 8 | 17 | 0.00056 | 0.056% | | 9 | 957 | 0.03135 | 3.135% | | 10 | 17019 | 0.55758 | 55.758% | | 11 | 11886 | 0.38941 | 38.941% | | 12 | 577 | 0.01890 | 1.890% | | 13 | 42 | 0.00138 | 0.138% | | 14 | 2 | 0.00007 | 0.007% | | Grand Total | 30523 | 1 | 100% |
Missing Data: 2601
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
