Click on a specific marker to view details
DYS390
DYS390 (CEPH 1331-01) Example Sequence:
TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/TCTG
/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/T
CTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTA/TCTA/TCTA/TCTA/TCA
TCTATCTATCTTTCCTTGTTTCTGAGTATACACATTGCAATGTTTTCATTTTACTGTCAC
25 repeats 220 bp (TCTG)8 (TCTA)12 (TCTG)1 (TCTA)4 Gene Diversity: 0.75855
| Alleles | Samples | Frequency | Percentage |
|---|
| 19 | 30 | 0.00090 | 0.090% | | 20 | 176 | 0.00527 | 0.527% | | 21 | 3947 | 0.11807 | 11.807% | | 22 | 3792 | 0.11344 | 11.344% | | 23 | 8373 | 0.25048 | 25.048% | | 23-24 | 2 | 0.00006 | 0.006% | | 24 | 12226 | 0.36574 | 36.574% | | 25 | 4486 | 0.13420 | 13.420% | | 26 | 366 | 0.01095 | 1.095% | | 27 | 29 | 0.00087 | 0.087% | | 28 | 1 | 0.00003 | 0.003% | | Grand Total | 33428 | 1 | 100% |
Missing Data: 2764
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
