Click on a specific marker to view details
DYS389II
DYS389II is a non-standard marker.Y-chromosome haplotypes are compared marker-by-marker to find which markers match, and which do not. The number of matching markers, along with the MRCA calculation, gives an indication of the relatedness of two individuals. However, it is not fully accurate to directly compare the DYS389II alleles of two genotypes. DYS389II is therefore handled specially, by the calculation (from the values of DYS389I and DYS389II) of a new marker, DYS389B (see the description of special-case handling of DYS389 for more information).
DYS389II (CEPH 1329-01) Example Sequence:
CCAACTCTCATCTGTATTATCTATGTGTGTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTA
/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TATTA
TACCTACTTCTGTATCCAACTCTCATCTGTATTATCTATGTA/TCTG/TCTG/TCTG/TCT
A/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCCCTCCCTCTATCAATCT
ATCTATTTATCTAGCAGTCCATCATCTATCTATGACATTCTTCTACTACTCAGGGATAAC
29 repeats 273 bp (TCTG)5 (TCTA)12 (TCTG)3 (TCTA)9 *Note: Bolded sequence is DYS389B.
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
|