Click on a specific marker to view details
DYS389I
DYS389I (CEPH 1329-01) Example Sequence:
CCAACTCTCATCTGTATTATCTATGTA/TCTG/TCTG/TCTG/TCTA/TCTA/TCT
A/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCCCTCCCTCTATCAATCTATCTA
TTTATCTAGCAGTCCATCATCTATCTATGACATTCTTCTACTACTCAGGGATAAC
12 repeats 154 bp (TCTG)3 (TCTA)9 Gene Diversity: 0.56000
| Alleles | Samples | Frequency | Percentage |
|---|
| 9 | 12 | 0.00037 | 0.037% | | 10 | 8 | 0.00025 | 0.025% | | 11 | 123 | 0.00381 | 0.381% | | 12 | 6490 | 0.20098 | 20.098% | | 13 | 19520 | 0.60448 | 60.448% | | 13-14 | 2 | 0.00006 | 0.006% | | 14 | 5970 | 0.18488 | 18.488% | | 15 | 163 | 0.00505 | 0.505% | | 16 | 4 | 0.00012 | 0.012% | | Grand Total | 32292 | 1 | 100% |
Missing Data: 3900
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
