Click on a specific marker to view details
DYS389I
DYS389I (CEPH 1329-01) Example Sequence:
CCAACTCTCATCTGTATTATCTATGTA/TCTG/TCTG/TCTG/TCTA/TCTA/TCT
A/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCCCTCCCTCTATCAATCTATCTA
TTTATCTAGCAGTCCATCATCTATCTATGACATTCTTCTACTACTCAGGGATAAC
12 repeats 154 bp (TCTG)3 (TCTA)9 Gene Diversity: 0.55840
| Alleles | Samples | Frequency | Percentage |
|---|
| 9 | 10 | 0.00034 | 0.034% | | 10 | 5 | 0.00017 | 0.017% | | 11 | 113 | 0.00383 | 0.383% | | 12 | 5915 | 0.20036 | 20.036% | | 13 | 17902 | 0.60640 | 60.640% | | 13-14 | 2 | 0.00007 | 0.007% | | 14 | 5421 | 0.18363 | 18.363% | | 15 | 150 | 0.00508 | 0.508% | | 16 | 4 | 0.00014 | 0.014% | | Grand Total | 29522 | 1 | 100% |
Missing Data: 3602
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
