Click on a specific marker to view details
DYS388
DYS388 (CEPH 1347-01) Example Sequence:
GAATTCATGTGAGTTAGCCGTTTAGCGATATATACATATTATGAAAC/ATT/ATT/AT
T/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/TGAGACGGACTCTCGC
TCTGTCGCCCAGGCTGGAGCGCAGTGGTGCGATCTGGCTCACTAAAAGCTCCGCCTC
13 repeats 159 bp (ATT)13 Gene Diversity: 0.44813
| Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 1 | 0.00003 | 0.003% | | 7 | 1 | 0.00003 | 0.003% | | 8 | 2 | 0.00006 | 0.006% | | 9 | 18 | 0.00050 | 0.050% | | 9-13 | 1 | 0.00003 | 0.003% | | 10 | 480 | 0.01328 | 1.328% | | 10.1 | 2 | 0.00006 | 0.006% | | 11 | 195 | 0.00540 | 0.540% | | 12 | 26348 | 0.72917 | 72.917% | | 12.2 | 2 | 0.00006 | 0.006% | | 13 | 3312 | 0.09166 | 9.166% | | 14 | 3593 | 0.09944 | 9.944% | | 15 | 1340 | 0.03708 | 3.708% | | 16 | 608 | 0.01683 | 1.683% | | 17 | 202 | 0.00559 | 0.559% | | 18 | 29 | 0.00080 | 0.080% | | Grand Total | 36134 | 1 | 100% |
Missing Data: 3059
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
