Home
|
Contact Us
|
FAQ
|
|
Sign In
Y-Chromosome Marker Details
THE DATABASE
Sorenson Database
Y-Chromosome Database
Search the Y-Database
Place/Time Analysis
Lineage Map
Paternal Surnames
Demographics
Statistics
Generation Interval
Marker Details
Marker Standards
Duplicated Markers
Marker DYS389
Marker DYS464
Mitochondrial Database
Sample Collection Map
Success Stories
Contact Us
Click on a specific marker to view details
MarkerMarkerMarkerMarkerMarker
DYS385DYS388DYS389BDYS389IDYS389II
DYS390DYS391DYS392DYS393DYS19
DYS426DYS437DYS438DYS439DYS441
DYS442DYS444DYS445DYS446DYS447
DYS448DYS449DYS452DYS454DYS455
DYS456DYS458DYS459DYS460DYS461
DYS462DYS463DYS464GGAAT1B07YCAII
Y-GATA-A10Y-GATA-C4GATA H4.1  
DYS388
DYS388 (CEPH 1347-01)
Example Sequence:
GAATTCATGTGAGTTAGCCGTTTAGCGATATATACATATTATGAAAC/ATT/ATT/AT
T/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/
TGAGACGGACTCTCGC
TCTGTCGCCCAGGCTGGAGCGCAGTGGTGCGATCTGG
CTCACTAAAAGCTCCGCCTC
13 repeats 159 bp (ATT)13
Gene Diversity: 0.44813

AllelesSamplesFrequencyPercentage
010.000030.003%
710.000030.003%
820.000060.006%
9180.000500.050%
9-1310.000030.003%
104800.013281.328%
10.120.000060.006%
111950.005400.540%
12263480.7291772.917%
12.220.000060.006%
1333120.091669.166%
1435930.099449.944%
1513400.037083.708%
166080.016831.683%
172020.005590.559%
18290.000800.080%
Grand Total361341100%
Missing Data: 3059

Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.

Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.

Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.   
Turquoise – Repeat is part of the primer
Site MapConditions of UsePrivacy PolicyCopyright © 2014 SMGF
Validated XHTML and CSS