Click on a specific marker to view details
DYS388
DYS388 (CEPH 1347-01) Example Sequence:
GAATTCATGTGAGTTAGCCGTTTAGCGATATATACATATTATGAAAC/ATT/ATT/AT
T/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/ATT/TGAGACGGACTCTCGC
TCTGTCGCCCAGGCTGGAGCGCAGTGGTGCGATCTGGCTCACTAAAAGCTCCGCCTC
13 repeats 159 bp (ATT)13 Gene Diversity: 0.43866
| Alleles | Samples | Frequency | Percentage |
|---|
| 7 | 1 | 0.00003 | 0.003% | | 8 | 3 | 0.00010 | 0.010% | | 9 | 14 | 0.00046 | 0.046% | | 9-13 | 1 | 0.00003 | 0.003% | | 10 | 366 | 0.01209 | 1.209% | | 11 | 134 | 0.00443 | 0.443% | | 12 | 22273 | 0.73596 | 73.596% | | 12.2 | 2 | 0.00007 | 0.007% | | 13 | 2713 | 0.08964 | 8.964% | | 14 | 3022 | 0.09985 | 9.985% | | 15 | 1079 | 0.03565 | 3.565% | | 16 | 481 | 0.01589 | 1.589% | | 17 | 150 | 0.00496 | 0.496% | | 18 | 25 | 0.00083 | 0.083% | | Grand Total | 30264 | 1 | 100% |
Missing Data: 2860
Scientific Reference: Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y-chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.
Turquoise – Repeat is part of the primer
| 
