Home
|
Contact Us
|
FAQ
|
|
Sign In
Y-Chromosome Marker Details
THE DATABASE
Sorenson Database
Y-Chromosome Database
Search the Y-Database
Place/Time Analysis
Lineage Map
Paternal Surnames
Demographics
Statistics
Generation Interval
Marker Details
Marker Standards
Duplicated Markers
Marker DYS389
Marker DYS464
Mitochondrial Database
Sample Collection Map
Success Stories
Contact Us
Click on a specific marker to view details
MarkerMarkerMarkerMarkerMarker
DYS385DYS388DYS389BDYS389IDYS389II
DYS390DYS391DYS392DYS393DYS19
DYS426DYS437DYS438DYS439DYS441
DYS442DYS444DYS445DYS446DYS447
DYS448DYS449DYS452DYS454DYS455
DYS456DYS458DYS459DYS460DYS461
DYS462DYS463DYS464GGAAT1B07YCAII
Y-GATA-A10Y-GATA-C4GATA H4.1  
DYS385  – duplicated marker
DYS385a (CEPH 1358-01)
Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGAAATG
AAATTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAAGAGA
AAAAGAGAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGG
AAGGAAGGAAGGAAGGAAGG
/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAA
A/GAAA/GAAA/GAAA/GAAA/
GAGAAAAAGAAAGGAGGACTATGTAATTGGC
11 repeats 257 bp (GAAA)11
DYS385b (CEPH 1358-01)
Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGAAATGAAA
TTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAAGAGAAAAAGA
GAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGGAAGGAAGGA
AGGAAGGAAGG
/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/
GAAA/GAAA/GAAA/GAAA/GAAA/
GAGAAAAAGAAAGGAGGACTATGTAATTGGC
14 repeats 269 bp (GAAA)14
Gene Diversity: 0.83367

HaplotypeSamplesFrequencyPercentage
0-020.000060.006%
7-910.000030.003%
7-1440.000110.011%
8-1470.000190.019%
8-1520.000060.006%
8-1640.000110.011%
9-1130.000080.008%
9-1240.000110.011%
9-1320.000060.006%
9-14470.001300.130%
9-1580.000220.022%
9-16270.000750.075%
9-1760.000170.017%
9-1940.000110.011%
10-10100.000280.028%
10-11250.000690.069%
10-12110.000300.030%
10-13420.001160.116%
10-13.210.000030.003%
10-144480.012411.241%
10-151200.003320.332%
10-16230.000640.064%
10-17220.000610.061%
10-18440.001220.122%
10-19260.000720.072%
10-20110.000300.030%
10-2120.000060.006%
10.2-1220.000060.006%
10.2-1310.000030.003%
10.2-1440.000110.011%
11-115330.014771.477%
11-123110.008620.862%
11-12-1420.000060.006%
11-12-1510.000030.003%
11-12-1710.000030.003%
11-1318670.051725.172%
11-13.2130.000360.036%
11-14105570.2924829.248%
11-14.230.000080.008%
11-1525270.070017.001%
11-15.240.000110.011%
11-164460.012361.236%
11-17610.001690.169%
11-18500.001390.139%
11-19100.000280.028%
11-2070.000190.019%
11-21140.000390.039%
11.2-1420.000060.006%
11.2-1510.000030.003%
11.2-1610.000030.003%
11.3-1220.000060.006%
12-124460.012361.236%
12-135360.014851.485%
12-13-1510.000030.003%
12-13-16180.000500.050%
12-13-1710.000030.003%
12-13.270.000190.019%
12-1413250.036713.671%
12-14-1620.000060.006%
12-14-1710.000030.003%
12-14-1830.000080.008%
12-155210.014431.443%
12-162070.005730.573%
12-171260.003490.349%
12-18800.002220.222%
12-19570.001580.158%
12-20620.001720.172%
12-21110.000300.030%
12-2230.000080.008%
12-2310.000030.003%
12.1-1410.000030.003%
12.3-1410.000030.003%
13-135410.014991.499%
13-1417490.048464.846%
13-14-1510.000030.003%
13-14-1650.000140.014%
13-157230.020032.003%
13-15.240.000110.011%
13-165940.016461.646%
13-175110.014161.416%
13-17.210.000030.003%
13-183480.009640.964%
13-191480.004100.410%
13-20730.002020.202%
13-21380.001050.105%
13-2290.000250.025%
13-2320.000060.006%
13.2-1510.000030.003%
13.2-1650.000140.014%
13.2-1740.000110.011%
14-1413380.037073.707%
14-14.210.000030.003%
14-1510570.029282.928%
14-165530.015321.532%
14-174680.012971.297%
14-182720.007540.754%
14-191170.003240.324%
14-20530.001470.147%
14-21130.000360.036%
14-2210.000030.003%
14-2510.000030.003%
14.2-1610.000030.003%
14.2-1710.000030.003%
15-157000.019391.939%
15-15.220.000060.006%
15-166610.018311.831%
15-16-1710.000030.003%
15-16.210.000030.003%
15-175030.013941.394%
15-183170.008780.878%
15-191480.004100.410%
15-20610.001690.169%
15-21160.000440.044%
15-2230.000080.008%
15-2390.000250.025%
15.1-1610.000030.003%
15.2-1610.000030.003%
15.2-1760.000170.017%
15.2-1840.000110.011%
16-163820.010581.058%
16-16.320.000060.006%
16-179870.027342.734%
16-17.220.000060.006%
16-187410.020532.053%
16-18-1910.000030.003%
16-193170.008780.878%
16-20570.001580.158%
16-2160.000170.017%
16-2210.000030.003%
16.2-1730.000080.008%
16.2-18160.000440.044%
16.2-1910.000030.003%
17-174610.012771.277%
17-17.210.000030.003%
17-186100.016901.690%
17-192090.005790.579%
17-20650.001800.180%
17-2180.000220.022%
17-2230.000080.008%
17.2-2010.000030.003%
18-182020.005600.560%
18-18.210.000030.003%
18-191000.002770.277%
18-20620.001720.172%
18-2150.000140.014%
18.1-1910.000030.003%
19-19240.000660.066%
19-20200.000550.055%
19-2110.000030.003%
20-2020.000060.006%
Grand Total360951100%
Missing Data: 3098
AllelesSamplesFrequencyPercentage
040.000060.006%
750.000070.007%
8130.000180.018%
91020.001410.141%
107950.011011.101%
10.270.000100.010%
11169680.2349223.492%
11.240.000060.006%
11.320.000030.003%
1241880.057985.798%
12.110.000010.001%
12.310.000010.001%
1377560.1073810.738%
13.2310.000430.043%
14193710.2681926.819%
14.260.000080.008%
1580850.1119411.194%
15.110.000010.001%
15.2210.000290.029%
1654280.075157.515%
16.2210.000290.029%
16.320.000030.003%
1745200.062586.258%
17.250.000070.007%
1830580.042344.234%
18.110.000010.001%
18.210.000010.001%
1912080.016721.672%
204760.006590.659%
211140.001580.158%
22200.000280.028%
23120.000170.017%
2510.000010.001%
Grand Total722281100%
Missing Data: 6196

Scientific Reference: Schneider, P., S. Meuser, W. Waiyawuth, Y., Seo, C. Rittner. 1998. Tandem repeat structure of the duplicated Y-chromosomal STR locus DYS385 and frequency studies in the German and three Asian populations. Forensic Sci. Int. 97:61-70.

Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.

Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.

Key to Sequence Data
Green – Forward and reverse primer sequence
Blue, Pink, and Orange – Repeat motif(s)
Gray – Non-repeating sequence.   
Turquoise – Repeat is part of the primer

Explanation of Duplicate Markers
Markers DYS385, DYS459, and YCAII are called "duplicate markers" since two values are present for each marker. At this time, it is not possible to determine the exact order of the two values for these markers.

We combine the two values for duplicated markers into a single value (e.g 11-12) for matching and for TMRCA calculations. However, the exact order might be 11-12 for one individual and 12-11 for another, yet both would be counted as a match.
Site MapConditions of UsePrivacy PolicyCopyright © 2014 SMGF
Validated XHTML and CSS