Click on a specific marker to view details
DYS385a (CEPH 1358-01) Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGAAATG
AAATTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAAGAGA
AAAAGAGAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGG
AAGGAAGGAAGGAAGGAAGG/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAA
A/GAAA/GAAA/GAAA/GAAA/GAGAAAAAGAAAGGAGGACTATGTAATTGGC
11 repeats 257 bp (GAAA)11 DYS385b (CEPH 1358-01) Example Sequence:
AGCATGGGTGACAGAGCTAGACACCATGCCAAACAACAACAAAGAAAAGAAATGAAA
TTCAGAAAGGAAGGAAGGAAGGAGAAAGAAAGTAAAAAAGAAAGAAAGAGAAAAAGA
GAAAAAGAAAGAAAGAGAAGAAAGAGAAAGAGGAAAGAGAAAGAAAGGAAGGAAGGA
AGGAAGGAAGG/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/
GAAA/GAAA/GAAA/GAAA/GAAA/GAGAAAAAGAAAGGAGGACTATGTAATTGGC
14 repeats 269 bp (GAAA)14 Gene Diversity: 0.83514
| Haplotype | Samples | Frequency | Percentage |
|---|
| 0-0 | 2 | 0.00006 | 0.006% | | 7-9 | 1 | 0.00003 | 0.003% | | 7-14 | 4 | 0.00011 | 0.011% | | 8-14 | 5 | 0.00014 | 0.014% | | 8-16 | 4 | 0.00011 | 0.011% | | 9-11 | 3 | 0.00008 | 0.008% | | 9-12 | 3 | 0.00008 | 0.008% | | 9-13 | 2 | 0.00006 | 0.006% | | 9-14 | 48 | 0.00136 | 0.136% | | 9-15 | 8 | 0.00023 | 0.023% | | 9-16 | 27 | 0.00076 | 0.076% | | 9-17 | 7 | 0.00020 | 0.020% | | 9-19 | 4 | 0.00011 | 0.011% | | 10-10 | 9 | 0.00025 | 0.025% | | 10-11 | 25 | 0.00071 | 0.071% | | 10-12 | 11 | 0.00031 | 0.031% | | 10-13 | 39 | 0.00110 | 0.110% | | 10-13.2 | 1 | 0.00003 | 0.003% | | 10-14 | 436 | 0.01234 | 1.234% | | 10-15 | 118 | 0.00334 | 0.334% | | 10-16 | 23 | 0.00065 | 0.065% | | 10-17 | 22 | 0.00062 | 0.062% | | 10-18 | 44 | 0.00125 | 0.125% | | 10-19 | 24 | 0.00068 | 0.068% | | 10-20 | 11 | 0.00031 | 0.031% | | 10-21 | 2 | 0.00006 | 0.006% | | 10.2-12 | 2 | 0.00006 | 0.006% | | 10.2-13 | 1 | 0.00003 | 0.003% | | 10.2-14 | 4 | 0.00011 | 0.011% | | 11-11 | 522 | 0.01478 | 1.478% | | 11-12 | 308 | 0.00872 | 0.872% | | 11-12-14 | 2 | 0.00006 | 0.006% | | 11-12-15 | 1 | 0.00003 | 0.003% | | 11-12-17 | 1 | 0.00003 | 0.003% | | 11-13 | 1818 | 0.05146 | 5.146% | | 11-13.2 | 13 | 0.00037 | 0.037% | | 11-14 | 10218 | 0.28923 | 28.923% | | 11-14.2 | 3 | 0.00008 | 0.008% | | 11-15 | 2459 | 0.06960 | 6.960% | | 11-15.2 | 4 | 0.00011 | 0.011% | | 11-16 | 433 | 0.01226 | 1.226% | | 11-17 | 57 | 0.00161 | 0.161% | | 11-18 | 51 | 0.00144 | 0.144% | | 11-19 | 10 | 0.00028 | 0.028% | | 11-20 | 6 | 0.00017 | 0.017% | | 11-21 | 14 | 0.00040 | 0.040% | | 11.2-14 | 2 | 0.00006 | 0.006% | | 11.2-15 | 1 | 0.00003 | 0.003% | | 11.2-16 | 1 | 0.00003 | 0.003% | | 11.3-12 | 2 | 0.00006 | 0.006% | | 12-12 | 442 | 0.01251 | 1.251% | | 12-13 | 526 | 0.01489 | 1.489% | | 12-13-15 | 1 | 0.00003 | 0.003% | | 12-13-16 | 19 | 0.00054 | 0.054% | | 12-13-17 | 1 | 0.00003 | 0.003% | | 12-13.2 | 6 | 0.00017 | 0.017% | | 12-14 | 1282 | 0.03629 | 3.629% | | 12-14-16 | 2 | 0.00006 | 0.006% | | 12-14-17 | 1 | 0.00003 | 0.003% | | 12-14-18 | 3 | 0.00008 | 0.008% | | 12-15 | 498 | 0.01410 | 1.410% | | 12-16 | 197 | 0.00558 | 0.558% | | 12-17 | 117 | 0.00331 | 0.331% | | 12-18 | 77 | 0.00218 | 0.218% | | 12-19 | 52 | 0.00147 | 0.147% | | 12-20 | 59 | 0.00167 | 0.167% | | 12-21 | 12 | 0.00034 | 0.034% | | 12-22 | 3 | 0.00008 | 0.008% | | 12-23 | 1 | 0.00003 | 0.003% | | 12.1-14 | 1 | 0.00003 | 0.003% | | 12.3-14 | 1 | 0.00003 | 0.003% | | 13-13 | 544 | 0.01540 | 1.540% | | 13-14 | 1699 | 0.04809 | 4.809% | | 13-14-15 | 1 | 0.00003 | 0.003% | | 13-14-16 | 5 | 0.00014 | 0.014% | | 13-15 | 706 | 0.01998 | 1.998% | | 13-15.2 | 4 | 0.00011 | 0.011% | | 13-16 | 570 | 0.01613 | 1.613% | | 13-17 | 498 | 0.01410 | 1.410% | | 13-18 | 331 | 0.00937 | 0.937% | | 13-19 | 127 | 0.00359 | 0.359% | | 13-20 | 63 | 0.00178 | 0.178% | | 13-21 | 37 | 0.00105 | 0.105% | | 13-22 | 9 | 0.00025 | 0.025% | | 13-23 | 2 | 0.00006 | 0.006% | | 13.2-15 | 1 | 0.00003 | 0.003% | | 13.2-16 | 5 | 0.00014 | 0.014% | | 13.2-17 | 4 | 0.00011 | 0.011% | | 14-14 | 1317 | 0.03728 | 3.728% | | 14-14.2 | 1 | 0.00003 | 0.003% | | 14-15 | 1022 | 0.02893 | 2.893% | | 14-16 | 543 | 0.01537 | 1.537% | | 14-17 | 467 | 0.01322 | 1.322% | | 14-18 | 263 | 0.00744 | 0.744% | | 14-19 | 113 | 0.00320 | 0.320% | | 14-20 | 48 | 0.00136 | 0.136% | | 14-21 | 13 | 0.00037 | 0.037% | | 14-22 | 1 | 0.00003 | 0.003% | | 14-25 | 1 | 0.00003 | 0.003% | | 14.2-16 | 1 | 0.00003 | 0.003% | | 14.2-17 | 1 | 0.00003 | 0.003% | | 15-15 | 696 | 0.01970 | 1.970% | | 15-15.2 | 2 | 0.00006 | 0.006% | | 15-16 | 666 | 0.01885 | 1.885% | | 15-16-17 | 1 | 0.00003 | 0.003% | | 15-16.2 | 1 | 0.00003 | 0.003% | | 15-17 | 518 | 0.01466 | 1.466% | | 15-18 | 335 | 0.00948 | 0.948% | | 15-19 | 139 | 0.00393 | 0.393% | | 15-20 | 62 | 0.00175 | 0.175% | | 15-21 | 15 | 0.00042 | 0.042% | | 15-22 | 3 | 0.00008 | 0.008% | | 15-23 | 9 | 0.00025 | 0.025% | | 15.2-16 | 1 | 0.00003 | 0.003% | | 15.2-17 | 6 | 0.00017 | 0.017% | | 15.2-18 | 4 | 0.00011 | 0.011% | | 16-16 | 395 | 0.01118 | 1.118% | | 16-16.3 | 2 | 0.00006 | 0.006% | | 16-17 | 1008 | 0.02853 | 2.853% | | 16-17.2 | 2 | 0.00006 | 0.006% | | 16-18 | 739 | 0.02092 | 2.092% | | 16-18-19 | 1 | 0.00003 | 0.003% | | 16-19 | 315 | 0.00892 | 0.892% | | 16-20 | 54 | 0.00153 | 0.153% | | 16-21 | 6 | 0.00017 | 0.017% | | 16-22 | 1 | 0.00003 | 0.003% | | 16.2-17 | 3 | 0.00008 | 0.008% | | 16.2-18 | 16 | 0.00045 | 0.045% | | 16.2-19 | 1 | 0.00003 | 0.003% | | 17-17 | 466 | 0.01319 | 1.319% | | 17-17.2 | 1 | 0.00003 | 0.003% | | 17-18 | 612 | 0.01732 | 1.732% | | 17-19 | 220 | 0.00623 | 0.623% | | 17-20 | 67 | 0.00190 | 0.190% | | 17-21 | 8 | 0.00023 | 0.023% | | 17-22 | 3 | 0.00008 | 0.008% | | 17.2-20 | 1 | 0.00003 | 0.003% | | 18-18 | 205 | 0.00580 | 0.580% | | 18-18.2 | 1 | 0.00003 | 0.003% | | 18-19 | 102 | 0.00289 | 0.289% | | 18-20 | 63 | 0.00178 | 0.178% | | 18-21 | 4 | 0.00011 | 0.011% | | 18.1-19 | 1 | 0.00003 | 0.003% | | 19-19 | 25 | 0.00071 | 0.071% | | 19-20 | 31 | 0.00088 | 0.088% | | 19-21 | 1 | 0.00003 | 0.003% | | 20-20 | 2 | 0.00006 | 0.006% | | Grand Total | 35328 | 1 | 100% |
Missing Data: 3119 | Alleles | Samples | Frequency | Percentage |
|---|
| 0 | 4 | 0.00006 | 0.006% | | 7 | 5 | 0.00007 | 0.007% | | 8 | 9 | 0.00013 | 0.013% | | 9 | 103 | 0.00146 | 0.146% | | 10 | 774 | 0.01095 | 1.095% | | 10.2 | 7 | 0.00010 | 0.010% | | 11 | 16470 | 0.23297 | 23.297% | | 11.2 | 4 | 0.00006 | 0.006% | | 11.3 | 2 | 0.00003 | 0.003% | | 12 | 4071 | 0.05759 | 5.759% | | 12.1 | 1 | 0.00001 | 0.001% | | 12.3 | 1 | 0.00001 | 0.001% | | 13 | 7547 | 0.10675 | 10.675% | | 13.2 | 30 | 0.00042 | 0.042% | | 14 | 18820 | 0.26621 | 26.621% | | 14.2 | 6 | 0.00008 | 0.008% | | 15 | 7959 | 0.11258 | 11.258% | | 15.2 | 21 | 0.00030 | 0.030% | | 16 | 5416 | 0.07661 | 7.661% | | 16.2 | 21 | 0.00030 | 0.030% | | 16.3 | 2 | 0.00003 | 0.003% | | 17 | 4555 | 0.06443 | 6.443% | | 17.2 | 4 | 0.00006 | 0.006% | | 18 | 3056 | 0.04323 | 4.323% | | 18.1 | 1 | 0.00001 | 0.001% | | 18.2 | 1 | 0.00001 | 0.001% | | 19 | 1191 | 0.01685 | 1.685% | | 20 | 469 | 0.00663 | 0.663% | | 21 | 112 | 0.00158 | 0.158% | | 22 | 20 | 0.00028 | 0.028% | | 23 | 12 | 0.00017 | 0.017% | | 25 | 1 | 0.00001 | 0.001% | | Grand Total | 70695 | 1 | 100% |
Missing Data: 6238
Scientific Reference: Schneider, P., S. Meuser, W. Waiyawuth, Y., Seo, C. Rittner. 1998. Tandem repeat structure of the duplicated Y-chromosomal STR locus DYS385 and frequency studies in the German and three Asian populations. Forensic Sci. Int. 97:61-70.
Butler, John M., R. Schoske, P. Vallone, M. Kline, A. Redd, M. Hammer. 2002. A Novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 129(1):10-24.
Gusmao, L., J.M. Butler, A. Carracedo, P. Gill, M. Kayser, W.R. Mayr, N. Morling, M. Prinz, L. Roewer, C. Tyler-Smith, P.M. Schneider. 2006. DNA Commission of the International Society of Forensic Genetics (ISFG): An update of the recommendations on the use of Y-STRs in forensic analysis. Forensic Sci. Int. 157:187-197.
Key to Sequence Data Green – Forward and reverse primer sequence Blue, Pink, and Orange – Repeat motif(s) Gray – Non-repeating sequence. Turquoise – Repeat is part of the primer
Explanation of Duplicate Markers
Markers DYS385, DYS459, and YCAII are called "duplicate markers" since two values are present for each marker. At this time, it is not possible to determine the exact order of the two values for these markers.
We combine the two values for duplicated markers into a single value (e.g 11-12) for matching and for TMRCA calculations. However, the exact order might be 11-12 for one individual and 12-11 for another, yet both would be counted as a match.
|